Junk DNA…Trashed Again | The Institute for Creation Research

Junk DNA…Trashed Again

Repetitious "words" in DNA represent more than half of the human genome's three billion nucleotides.1 Because human reasoning essentially views the repetition of words in spoken languages as errors, these DNA sequences were first written off as meaningless junk. Secular scientists assumed that natural processes somehow produced the repeats over eons of evolution through accidental duplications and that these accidents were carried along in the genome as useless baggage. Now it appears nothing could be further from the truth since these repetitive words are linked with pervasive biochemical function.1

One class of repetitious human genome sequences recently highlighted in the news is called tandem repeats (TRs). These are simply stretches of DNA comprised of two or more contiguous copies of a "word" (called a motif) arranged in a head-to-tail pattern. For example, the TR "ttacttacttacttacgttac" is simply a repeat of the four-base motif "ttac" five times. Amazingly, these TRs are found all over the human genome: inside genes, outside genes, and even inside the protein-coding regions of genes. Among individual humans, many TRs vary in the length of the repeat. They have been used in forensics as highly effective DNA markers to solve criminal and paternity cases.

Despite knowing about these TR sequences and using them as reliable genetic markers, scientists have known very little about their actual function. Historically, anomalies like these repeating sequences, that seem to make little sense upon first glance, were often relegated to the trash bin of "junk DNA."

However, one group of researchers recently took a different approach and hypothesized that these sequences may have a purpose. They developed a set of experiments to test the effect of TRs on gene expression and the epigenetic modification of DNA. Epigenetic modification is the addition of molecular tags to the DNA molecule without changing the actual DNA sequence. The result is altered gene expression.

As a consequence of extensive testing using both existing and newly generated data sets, the researchers proclaim, "Our results suggest that there are potentially thousands of TR variants in the human genome that exert functional effects via alterations of local gene expression or epigenetics." They also state,

Our study assigns biological significance to TR variations in the human genome, and suggests that a significant fraction of TR variations exert functional effects via alterations of local gene expression or epigenetics. We conclude that targeted studies that focus on genotyping [genetic testing] TR variants are required to fully ascertain functional variation in the genome.1

These new data confirm a variety of previous studies that uncovered evidence of the functional role of TRs from their association with human diseases. As it turns out, several dozen heritable human diseases are directly associated with large repeat expansions in either coding or non-protein-coding regions of the genome.2 Clearly, these regions are under tight genetic control. When the repeats go outside their boundaries of allowable length variation, disease may be the result.

Once more we have a glaring example of demonstrated function in the genome for something once declared non-functional merely based on the fact that scientists didn't know its function—as if a lack of knowledge and understanding could somehow provide an adequate answer.

If a design-based approach were more widely taken during the course of genomic discovery, just think how much improvement would take place in our understanding of currently unknown features. Such an approach would also give glory to our great omnipotent Creator who is the Master Designer and Engineer of all life.

References

  1. Quilez, J. et al. 2016. Polymorphic tandem repeats within gene promoters act as modifiers of gene expression and DNA methylation in humans. Nucleic Acids Research. 44 (8): 3750-3762.
  2. Gemayel, R., M. D. Vinces, M. Legendre, and K. J. Verstrepen. 2010. Variable tandem repeats accelerate evolution of coding and regulatory sequences. Annual Review Genetics. 44: 445-477.

*Dr. Tomkins is Director of Life Sciences at the Institute for Creation Research and earned his Ph.D. in genetics from Clemson University.

Article posted on May 26, 2016.

The Latest
NEWS
Under the Alerce Trees: A Hidden Fungal Ecosystem
Some of the oldest living trees on Earth are in the temperate rainforests of the Chilean Coast Range. Second only to the bristlecone pine in age, these...

NEWS
God’s Architecture: The Hidden Biology in a Paris Icon
In 1889, Paris hosted the Exposition Universelle, a world’s fair celebrating the hundredth anniversary of the French Revolution. To mark the occasion,...

NEWS
Chemical Clues Raise Questions About Early Animals
What if a simple sea sponge could spark a debate about the origin of animal life? A recent study suggests that some of Earth’s earliest animals...

NEWS
Alive with Christ
“Now if we be dead with Christ, we believe that we shall also live with him: knowing that Christ being raised from the dead dieth no more; death...

NEWS
April 2026 Wallpaper
"Ask the Lord for rain in the time of the latter rain. The Lord will make flashing clouds; He will give them showers of rain, Grass in the field...

NEWS
Does Earth Have a Twin?
A possible Earth-like planet 146 light-years away has recently been discovered by citizen scientists.1 The evolutionary community is cautiously...

CREATION PODCAST
Christian PhDs: 5 New Discoveries That Have Atheists SCRAMBLING
From the depths of outer space to the microscopic strands of our DNA, recent scientific discoveries are telling a story secular scientists are scrambling...

NEWS
Giant Virus, Big Claims: Does Ushikuvirus Explain Complex Life?
A newly discovered giant virus called ushikuvirus has been described by conventional scientists as a possible clue to how complex cells evolved. But...

NEWS
Conventional Science Still Struggling to Exhume the Great Unconformity
The book of Genesis tells us about a global flood that occurred about 4,500 years ago, an event that began with the bursting of the fountains of the...

NEWS
Designed to Handle Oxygen: Lessons from Asgard Archaea
Oxygen gives cells energy. But oxygen can also harm cells. Any organism that uses oxygen must both harness the power and protect itself against being...