Junk DNA…Trashed Again | The Institute for Creation Research

Junk DNA…Trashed Again

Repetitious "words" in DNA represent more than half of the human genome's three billion nucleotides.1 Because human reasoning essentially views the repetition of words in spoken languages as errors, these DNA sequences were first written off as meaningless junk. Secular scientists assumed that natural processes somehow produced the repeats over eons of evolution through accidental duplications and that these accidents were carried along in the genome as useless baggage. Now it appears nothing could be further from the truth since these repetitive words are linked with pervasive biochemical function.1

One class of repetitious human genome sequences recently highlighted in the news is called tandem repeats (TRs). These are simply stretches of DNA comprised of two or more contiguous copies of a "word" (called a motif) arranged in a head-to-tail pattern. For example, the TR "ttacttacttacttacgttac" is simply a repeat of the four-base motif "ttac" five times. Amazingly, these TRs are found all over the human genome: inside genes, outside genes, and even inside the protein-coding regions of genes. Among individual humans, many TRs vary in the length of the repeat. They have been used in forensics as highly effective DNA markers to solve criminal and paternity cases.

Despite knowing about these TR sequences and using them as reliable genetic markers, scientists have known very little about their actual function. Historically, anomalies like these repeating sequences, that seem to make little sense upon first glance, were often relegated to the trash bin of "junk DNA."

However, one group of researchers recently took a different approach and hypothesized that these sequences may have a purpose. They developed a set of experiments to test the effect of TRs on gene expression and the epigenetic modification of DNA. Epigenetic modification is the addition of molecular tags to the DNA molecule without changing the actual DNA sequence. The result is altered gene expression.

As a consequence of extensive testing using both existing and newly generated data sets, the researchers proclaim, "Our results suggest that there are potentially thousands of TR variants in the human genome that exert functional effects via alterations of local gene expression or epigenetics." They also state,

Our study assigns biological significance to TR variations in the human genome, and suggests that a significant fraction of TR variations exert functional effects via alterations of local gene expression or epigenetics. We conclude that targeted studies that focus on genotyping [genetic testing] TR variants are required to fully ascertain functional variation in the genome.1

These new data confirm a variety of previous studies that uncovered evidence of the functional role of TRs from their association with human diseases. As it turns out, several dozen heritable human diseases are directly associated with large repeat expansions in either coding or non-protein-coding regions of the genome.2 Clearly, these regions are under tight genetic control. When the repeats go outside their boundaries of allowable length variation, disease may be the result.

Once more we have a glaring example of demonstrated function in the genome for something once declared non-functional merely based on the fact that scientists didn't know its function—as if a lack of knowledge and understanding could somehow provide an adequate answer.

If a design-based approach were more widely taken during the course of genomic discovery, just think how much improvement would take place in our understanding of currently unknown features. Such an approach would also give glory to our great omnipotent Creator who is the Master Designer and Engineer of all life.

References

  1. Quilez, J. et al. 2016. Polymorphic tandem repeats within gene promoters act as modifiers of gene expression and DNA methylation in humans. Nucleic Acids Research. 44 (8): 3750-3762.
  2. Gemayel, R., M. D. Vinces, M. Legendre, and K. J. Verstrepen. 2010. Variable tandem repeats accelerate evolution of coding and regulatory sequences. Annual Review Genetics. 44: 445-477.

*Dr. Tomkins is Director of Life Sciences at the Institute for Creation Research and earned his Ph.D. in genetics from Clemson University.

Article posted on May 26, 2016.

The Latest
NEWS
The Brain’s Amazing Ability of Visual Perception
Scientists will never fully understand the brain’s operation.1,2,3 As neurological research continues, it will only reveal more...

ACTS & FACTS
Continuous Environmental Tracking : An Engineering-Based Model...
Purpose The Institute for Creation Research is engaged in our biggest science initiative in the last two decades, and it could be our most important...

ACTS & FACTS
CET: Testing the Cavefish Model
Staff Writer Purpose The Institute for Creation Research (ICR) is testing an engineering- based model of rapid biological adaptation called...

ACTS & FACTS
Original Biochemistry in Fossils
Purpose In 1997, paleontologist Dr. Mary Schweitzer accidentally stumbled upon what appeared to be blood vessels and blood cells from a T. rex...

ACTS & FACTS
Debunking an Iconic Uniformitarian Ice Age Theory
Purpose The Milankovitch, or astronomical, theory holds that the timing of Ice Ages is controlled by slow changes in Earth’s orbital and...

ACTS & FACTS
ICR and Explaining the Ice Age
by Larry Vardiman, Ph.D., and Michael J. Oard, M.S.* Purpose There is strong geological evidence for an Ice Age, so the Institute for Creation...

ACTS & FACTS
Planetary Magnetism
Purpose In 1971, Dr. Thomas Barnes publicized a then “trade secret” of scientists studying the earth’s magnetic field, which...

ACTS & FACTS
Cosmology Research
Purpose Taking the Hebrew text of Scripture at face value without inserting gaps or revising the meanings, the universe is only about 6,000 years...

ACTS & FACTS
The Coconino Sandstone: Water, not Wind
Purpose The Coconino Sandstone is one of the most well-known formations in Grand Canyon. The blond-colored sandstone, just three layers down from...

ACTS & FACTS
Global Stratigraphy Supports a Progressive Worldwide Flood
Purpose Is there geological evidence for a global flood? Is there evidence that the waters rose and peaked on Day 150 as recorded in Genesis 8?...