Junk DNA…Trashed Again | The Institute for Creation Research

Junk DNA…Trashed Again

Repetitious "words" in DNA represent more than half of the human genome's three billion nucleotides.1 Because human reasoning essentially views the repetition of words in spoken languages as errors, these DNA sequences were first written off as meaningless junk. Secular scientists assumed that natural processes somehow produced the repeats over eons of evolution through accidental duplications and that these accidents were carried along in the genome as useless baggage. Now it appears nothing could be further from the truth since these repetitive words are linked with pervasive biochemical function.1

One class of repetitious human genome sequences recently highlighted in the news is called tandem repeats (TRs). These are simply stretches of DNA comprised of two or more contiguous copies of a "word" (called a motif) arranged in a head-to-tail pattern. For example, the TR "ttacttacttacttacgttac" is simply a repeat of the four-base motif "ttac" five times. Amazingly, these TRs are found all over the human genome: inside genes, outside genes, and even inside the protein-coding regions of genes. Among individual humans, many TRs vary in the length of the repeat. They have been used in forensics as highly effective DNA markers to solve criminal and paternity cases.

Despite knowing about these TR sequences and using them as reliable genetic markers, scientists have known very little about their actual function. Historically, anomalies like these repeating sequences, that seem to make little sense upon first glance, were often relegated to the trash bin of "junk DNA."

However, one group of researchers recently took a different approach and hypothesized that these sequences may have a purpose. They developed a set of experiments to test the effect of TRs on gene expression and the epigenetic modification of DNA. Epigenetic modification is the addition of molecular tags to the DNA molecule without changing the actual DNA sequence. The result is altered gene expression.

As a consequence of extensive testing using both existing and newly generated data sets, the researchers proclaim, "Our results suggest that there are potentially thousands of TR variants in the human genome that exert functional effects via alterations of local gene expression or epigenetics." They also state,

Our study assigns biological significance to TR variations in the human genome, and suggests that a significant fraction of TR variations exert functional effects via alterations of local gene expression or epigenetics. We conclude that targeted studies that focus on genotyping [genetic testing] TR variants are required to fully ascertain functional variation in the genome.1

These new data confirm a variety of previous studies that uncovered evidence of the functional role of TRs from their association with human diseases. As it turns out, several dozen heritable human diseases are directly associated with large repeat expansions in either coding or non-protein-coding regions of the genome.2 Clearly, these regions are under tight genetic control. When the repeats go outside their boundaries of allowable length variation, disease may be the result.

Once more we have a glaring example of demonstrated function in the genome for something once declared non-functional merely based on the fact that scientists didn't know its function—as if a lack of knowledge and understanding could somehow provide an adequate answer.

If a design-based approach were more widely taken during the course of genomic discovery, just think how much improvement would take place in our understanding of currently unknown features. Such an approach would also give glory to our great omnipotent Creator who is the Master Designer and Engineer of all life.

References

  1. Quilez, J. et al. 2016. Polymorphic tandem repeats within gene promoters act as modifiers of gene expression and DNA methylation in humans. Nucleic Acids Research. 44 (8): 3750-3762.
  2. Gemayel, R., M. D. Vinces, M. Legendre, and K. J. Verstrepen. 2010. Variable tandem repeats accelerate evolution of coding and regulatory sequences. Annual Review Genetics. 44: 445-477.

*Dr. Tomkins is Director of Life Sciences at the Institute for Creation Research and earned his Ph.D. in genetics from Clemson University.

Article posted on May 26, 2016.

The Latest
NEWS
Getting Carbon into the First Cell
Today’s secular mindset replaces “In the beginning God…” with “In the beginning, hydrogen….” The extreme specificity...

NEWS
Secular Science Struggles to Explain Origin of Earth’s Water
Tim Clarey, Ph.D., and Jake Hebert, Ph.D. Secular scientists continue to struggle to explain the origin of Earth’s water. And a new study...

NEWS
South American Plant Fossils Confirm Flood Boundary
Jeffrey P. Tomkins, Ph.D., and Tim Clarey, Ph.D. Fossil pollen, leaf and fruit impressions, and petrified wood taken from multiple locations...

NEWS
Record-Breaking Mouse, Higher Than Any Mammal
Recently, researchers have reported on the world’s “highest-dwelling mammal,” the yellow-rumped leaf-eared mouse, observed upon a dormant...

NEWS
Was This Cave Bear Really “Prehistoric”?
The preserved carcass of a “prehistoric” cave bear has been discovered in melting permafrost on an Arctic Russian Island.1,2 Reindeer...

NEWS
Have Scientists Found Life on Venus?
Secular scientists are obsessed with attempting to show that life on Earth is not unique and therefore must exist, if not elsewhere in our solar system...

NEWS
Inside October 2020 Acts & Facts
What is ICR’s vision for the next chapter of creation ministry? Why do mosquitoes attack humans? How did we celebrate the first anniversary of...

ACTS & FACTS
Abound in This Grace
One of the strongest exhortations for Christian giving is found in Paul’s encouragement to the believers in Corinth. In 2 Corinthians 8, Paul...

APOLOGETICS
Food Web Ecology Corroborates Scripture
Real-world ecology supports the Bible’s trustworthiness. Accordingly, how creatures get and use food matches how Scripture describes our world.1-3 Food...

ACTS & FACTS
Leviathan: Legend, Croc, or Something Else?
In Job 41, God points Job’s attention to a terrifying animal called leviathan. It’s clear this was a real creature, but what was it? Bible...