Junk DNA…Trashed Again | The Institute for Creation Research

Junk DNA…Trashed Again

Repetitious "words" in DNA represent more than half of the human genome's three billion nucleotides.1 Because human reasoning essentially views the repetition of words in spoken languages as errors, these DNA sequences were first written off as meaningless junk. Secular scientists assumed that natural processes somehow produced the repeats over eons of evolution through accidental duplications and that these accidents were carried along in the genome as useless baggage. Now it appears nothing could be further from the truth since these repetitive words are linked with pervasive biochemical function.1

One class of repetitious human genome sequences recently highlighted in the news is called tandem repeats (TRs). These are simply stretches of DNA comprised of two or more contiguous copies of a "word" (called a motif) arranged in a head-to-tail pattern. For example, the TR "ttacttacttacttacgttac" is simply a repeat of the four-base motif "ttac" five times. Amazingly, these TRs are found all over the human genome: inside genes, outside genes, and even inside the protein-coding regions of genes. Among individual humans, many TRs vary in the length of the repeat. They have been used in forensics as highly effective DNA markers to solve criminal and paternity cases.

Despite knowing about these TR sequences and using them as reliable genetic markers, scientists have known very little about their actual function. Historically, anomalies like these repeating sequences, that seem to make little sense upon first glance, were often relegated to the trash bin of "junk DNA."

However, one group of researchers recently took a different approach and hypothesized that these sequences may have a purpose. They developed a set of experiments to test the effect of TRs on gene expression and the epigenetic modification of DNA. Epigenetic modification is the addition of molecular tags to the DNA molecule without changing the actual DNA sequence. The result is altered gene expression.

As a consequence of extensive testing using both existing and newly generated data sets, the researchers proclaim, "Our results suggest that there are potentially thousands of TR variants in the human genome that exert functional effects via alterations of local gene expression or epigenetics." They also state,

Our study assigns biological significance to TR variations in the human genome, and suggests that a significant fraction of TR variations exert functional effects via alterations of local gene expression or epigenetics. We conclude that targeted studies that focus on genotyping [genetic testing] TR variants are required to fully ascertain functional variation in the genome.1

These new data confirm a variety of previous studies that uncovered evidence of the functional role of TRs from their association with human diseases. As it turns out, several dozen heritable human diseases are directly associated with large repeat expansions in either coding or non-protein-coding regions of the genome.2 Clearly, these regions are under tight genetic control. When the repeats go outside their boundaries of allowable length variation, disease may be the result.

Once more we have a glaring example of demonstrated function in the genome for something once declared non-functional merely based on the fact that scientists didn't know its function—as if a lack of knowledge and understanding could somehow provide an adequate answer.

If a design-based approach were more widely taken during the course of genomic discovery, just think how much improvement would take place in our understanding of currently unknown features. Such an approach would also give glory to our great omnipotent Creator who is the Master Designer and Engineer of all life.

References

  1. Quilez, J. et al. 2016. Polymorphic tandem repeats within gene promoters act as modifiers of gene expression and DNA methylation in humans. Nucleic Acids Research. 44 (8): 3750-3762.
  2. Gemayel, R., M. D. Vinces, M. Legendre, and K. J. Verstrepen. 2010. Variable tandem repeats accelerate evolution of coding and regulatory sequences. Annual Review Genetics. 44: 445-477.

*Dr. Tomkins is Director of Life Sciences at the Institute for Creation Research and earned his Ph.D. in genetics from Clemson University.

Article posted on May 26, 2016.

The Latest
NEWS
Dolphins Learn Tricks from Peers to Catch Fish
Dolphins—like other cetaceans such as whales, wholphins, and porpoises—are highly intelligent marine mammals, capable of astonishing feats....

NEWS
Liberty and the Word of God
“And I will walk at liberty: for I seek thy precepts” (Psalm 119:45). July 4th is called Independence Day here in our country because on...

NEWS
Wandering Albatross: Wide Wings on the Winds
Wandering albatrosses have the largest wingspan of any living bird, so they live much of life soaring above the oceans. With their wings—and a lot...

NEWS
Inside July 2020 Acts & Facts
Where can we find hope during times of waiting? How has ICR reached a new global audience? How does evolution conflict with the Bible's teaching...

NEWS
Soft Dinosaur Eggs Deflate Bird-Dinosaur Evolution
A pair of new studies found that some dinosaurs, and possibly some marine reptiles, laid squishy eggs. One study discovered that many dinosaurs, like turtles...

ACTS & FACTS
Encouraging Notes During the Storm
Without a doubt, the global spread of COVID-19 has forced most of us to make major adjustments to our daily routines. Whether the stay-at-home mandates...

APOLOGETICS
God's Grassroots Provision
In times of calamity and crisis, it’s easy to question whether life makes sense—or, more accurately, how God is making ultimate sense of...

ACTS & FACTS
Why Do I Believe in Recent Creation?
A student recently asked what I believe about the age of the earth. I replied that at one time I felt absolutely certain that the world was billions...

ACTS & FACTS
Walton's Cosmic Temple Is a House of Cards
A series of books and videos by Dr. John Walton, an Old Testament theologian at Wheaton College, has made a huge splash in the evangelical community...

ACTS & FACTS
Evolution's Death Versus Jesus' Death
Cancer took the life of both my dad and a friend in the last several months. Death certainly injects misery into the joys of life. I know we must die,...