Junk DNA…Trashed Again | The Institute for Creation Research

Junk DNA…Trashed Again

Repetitious "words" in DNA represent more than half of the human genome's three billion nucleotides.1 Because human reasoning essentially views the repetition of words in spoken languages as errors, these DNA sequences were first written off as meaningless junk. Secular scientists assumed that natural processes somehow produced the repeats over eons of evolution through accidental duplications and that these accidents were carried along in the genome as useless baggage. Now it appears nothing could be further from the truth since these repetitive words are linked with pervasive biochemical function.1

One class of repetitious human genome sequences recently highlighted in the news is called tandem repeats (TRs). These are simply stretches of DNA comprised of two or more contiguous copies of a "word" (called a motif) arranged in a head-to-tail pattern. For example, the TR "ttacttacttacttacgttac" is simply a repeat of the four-base motif "ttac" five times. Amazingly, these TRs are found all over the human genome: inside genes, outside genes, and even inside the protein-coding regions of genes. Among individual humans, many TRs vary in the length of the repeat. They have been used in forensics as highly effective DNA markers to solve criminal and paternity cases.

Despite knowing about these TR sequences and using them as reliable genetic markers, scientists have known very little about their actual function. Historically, anomalies like these repeating sequences, that seem to make little sense upon first glance, were often relegated to the trash bin of "junk DNA."

However, one group of researchers recently took a different approach and hypothesized that these sequences may have a purpose. They developed a set of experiments to test the effect of TRs on gene expression and the epigenetic modification of DNA. Epigenetic modification is the addition of molecular tags to the DNA molecule without changing the actual DNA sequence. The result is altered gene expression.

As a consequence of extensive testing using both existing and newly generated data sets, the researchers proclaim, "Our results suggest that there are potentially thousands of TR variants in the human genome that exert functional effects via alterations of local gene expression or epigenetics." They also state,

Our study assigns biological significance to TR variations in the human genome, and suggests that a significant fraction of TR variations exert functional effects via alterations of local gene expression or epigenetics. We conclude that targeted studies that focus on genotyping [genetic testing] TR variants are required to fully ascertain functional variation in the genome.1

These new data confirm a variety of previous studies that uncovered evidence of the functional role of TRs from their association with human diseases. As it turns out, several dozen heritable human diseases are directly associated with large repeat expansions in either coding or non-protein-coding regions of the genome.2 Clearly, these regions are under tight genetic control. When the repeats go outside their boundaries of allowable length variation, disease may be the result.

Once more we have a glaring example of demonstrated function in the genome for something once declared non-functional merely based on the fact that scientists didn't know its function—as if a lack of knowledge and understanding could somehow provide an adequate answer.

If a design-based approach were more widely taken during the course of genomic discovery, just think how much improvement would take place in our understanding of currently unknown features. Such an approach would also give glory to our great omnipotent Creator who is the Master Designer and Engineer of all life.

References

  1. Quilez, J. et al. 2016. Polymorphic tandem repeats within gene promoters act as modifiers of gene expression and DNA methylation in humans. Nucleic Acids Research. 44 (8): 3750-3762.
  2. Gemayel, R., M. D. Vinces, M. Legendre, and K. J. Verstrepen. 2010. Variable tandem repeats accelerate evolution of coding and regulatory sequences. Annual Review Genetics. 44: 445-477.

*Dr. Tomkins is Director of Life Sciences at the Institute for Creation Research and earned his Ph.D. in genetics from Clemson University.

Article posted on May 26, 2016.

The Latest
NEWS
Give Today and Support Biblical Creation Ministry
North Texas Giving Day is here once again! Will you help us reach the next generation? Your generosity will empower ICR and our Dallas Museum—the...

NEWS
Mammalian Brains Prove Evolutionary Disconnect
The evolutionary model of brain development predicted that the complexity of neural connectivity should have increased as brains became larger and the...

NEWS
North Texas Giving Day Next Week!
North Texas Giving Day is almost here! Will you help us reach the next generation? Your generosity will empower ICR and the ICR Discovery Center for Science...

NEWS
Celebrating One Year at the ICR Discovery Center
Thank you to all who joined us for the ICR Discovery Center for Science & Earth History’s First Anniversary Celebration! ICR staff enjoyed meeting...

NEWS
New Evidence Hurts Feathered Dinosaur Theory
Is a dinosaur still a dinosaur if it has flight feathers? A new study points to some fascinating evidence that contradicts the idea of feathered dinosaurs...

NEWS
New Planetarium Show: Exploring Deep Space
The ICR Discovery Center for Science & Earth History is celebrating its first anniversary since the Grand Opening on September 2, 2019. To commemorate...

NEWS
Inside September 2020 Acts & Facts
What's the story behind ICR's new President? What milestone are we celebrating this month at the ICR Discovery Center? How do comets affirm...

NEWS
Sunflower Heliotropism: August Sunlight for Making Tons of Seeds
August is an important month for sunflowers—those gigantic, bright-yellow flowers with brownish, round seed heads bordered by radiating yellow ligules...

ACTS & FACTS
One Generation Away
In 1967, Ronald Reagan delivered one of the most memorable lines of his storied career: “Freedom…is never more than one generation away...

APOLOGETICS
Matthew Maury's Paths of the Sea
Today’s oceanography and meteorology owe a great debt to Matthew Maury. He exemplified the biblical principle that whatever we do, we should do...