Junk DNA…Trashed Again | The Institute for Creation Research

Junk DNA…Trashed Again

Repetitious "words" in DNA represent more than half of the human genome's three billion nucleotides.1 Because human reasoning essentially views the repetition of words in spoken languages as errors, these DNA sequences were first written off as meaningless junk. Secular scientists assumed that natural processes somehow produced the repeats over eons of evolution through accidental duplications and that these accidents were carried along in the genome as useless baggage. Now it appears nothing could be further from the truth since these repetitive words are linked with pervasive biochemical function.1

One class of repetitious human genome sequences recently highlighted in the news is called tandem repeats (TRs). These are simply stretches of DNA comprised of two or more contiguous copies of a "word" (called a motif) arranged in a head-to-tail pattern. For example, the TR "ttacttacttacttacgttac" is simply a repeat of the four-base motif "ttac" five times. Amazingly, these TRs are found all over the human genome: inside genes, outside genes, and even inside the protein-coding regions of genes. Among individual humans, many TRs vary in the length of the repeat. They have been used in forensics as highly effective DNA markers to solve criminal and paternity cases.

Despite knowing about these TR sequences and using them as reliable genetic markers, scientists have known very little about their actual function. Historically, anomalies like these repeating sequences, that seem to make little sense upon first glance, were often relegated to the trash bin of "junk DNA."

However, one group of researchers recently took a different approach and hypothesized that these sequences may have a purpose. They developed a set of experiments to test the effect of TRs on gene expression and the epigenetic modification of DNA. Epigenetic modification is the addition of molecular tags to the DNA molecule without changing the actual DNA sequence. The result is altered gene expression.

As a consequence of extensive testing using both existing and newly generated data sets, the researchers proclaim, "Our results suggest that there are potentially thousands of TR variants in the human genome that exert functional effects via alterations of local gene expression or epigenetics." They also state,

Our study assigns biological significance to TR variations in the human genome, and suggests that a significant fraction of TR variations exert functional effects via alterations of local gene expression or epigenetics. We conclude that targeted studies that focus on genotyping [genetic testing] TR variants are required to fully ascertain functional variation in the genome.1

These new data confirm a variety of previous studies that uncovered evidence of the functional role of TRs from their association with human diseases. As it turns out, several dozen heritable human diseases are directly associated with large repeat expansions in either coding or non-protein-coding regions of the genome.2 Clearly, these regions are under tight genetic control. When the repeats go outside their boundaries of allowable length variation, disease may be the result.

Once more we have a glaring example of demonstrated function in the genome for something once declared non-functional merely based on the fact that scientists didn't know its function—as if a lack of knowledge and understanding could somehow provide an adequate answer.

If a design-based approach were more widely taken during the course of genomic discovery, just think how much improvement would take place in our understanding of currently unknown features. Such an approach would also give glory to our great omnipotent Creator who is the Master Designer and Engineer of all life.

References

  1. Quilez, J. et al. 2016. Polymorphic tandem repeats within gene promoters act as modifiers of gene expression and DNA methylation in humans. Nucleic Acids Research. 44 (8): 3750-3762.
  2. Gemayel, R., M. D. Vinces, M. Legendre, and K. J. Verstrepen. 2010. Variable tandem repeats accelerate evolution of coding and regulatory sequences. Annual Review Genetics. 44: 445-477.

*Dr. Tomkins is Director of Life Sciences at the Institute for Creation Research and earned his Ph.D. in genetics from Clemson University.

Article posted on May 26, 2016.

The Latest
NEWS
Thanks for Everything
“Giving thanks always for all things unto God and the Father in the name of our Lord Jesus Christ.” (Ephesians 5:20) Being thankful for...

NEWS
Even Sherlock Holmes Can’t Explain African Dinosaurs
A new species of duck-billed dinosaur, Ajnabia odysseus, was recently unearthed in North Africa.1 This is the first hadrosaur-type dinosaur...

NEWS
Glow-in-the-Dark Platypuses Illuminate the Creator
The platypus is perhaps the most evolution-defying creature on Earth. It’s not enough that it’s a mammal that lays eggs, has a bill like a...

NEWS
Rapid Crystal Growth Supports Flood Model
Secular scientists are finding exactly what Flood geologists have predicted all along—huge crystals can and did grow extremely fast. In other words,...

NEWS
Hot Neptune Atmosphere "Shouldn't Exist"
An exoplanet 260 light-years away is being described as the first of its kind ever detected.1,2 This exoplanet, catalogued as LTT 9779b, is...

NEWS
Inside November 2020 Acts & Facts
Where can we see God’s engineering? What is ICR’s new scientific theory? How do hummingbirds reveal God’s design? How can you refute...

ACTS & FACTS
Thankful Remembrance
We all have so much to be thankful for. Even after such a trying year, we must admit that God has been so very good to us. The Lord has not only shown...

APOLOGETICS
Mayflower Pilgrims, Simian DNA, and Straw Men
Both the Mayflower Pilgrims and biblical creationists are unjustly targeted for straw man vilifications using misleading, false accusations. A straw...

ACTS & FACTS
How Can You Refute Evolution?
Darwinian evolution promotes a mantra that “all creatures great and small—natural processes made them all.” Just one creature somehow...

ACTS & FACTS
Hummingbirds by Design
Zoologists have wonder and appreciation for the animals they investigate, whether the creatures fly through air, swim in water, or walk on land. Stanford...