Junk DNA…Trashed Again | The Institute for Creation Research

Junk DNA…Trashed Again

Repetitious "words" in DNA represent more than half of the human genome's three billion nucleotides.1 Because human reasoning essentially views the repetition of words in spoken languages as errors, these DNA sequences were first written off as meaningless junk. Secular scientists assumed that natural processes somehow produced the repeats over eons of evolution through accidental duplications and that these accidents were carried along in the genome as useless baggage. Now it appears nothing could be further from the truth since these repetitive words are linked with pervasive biochemical function.1

One class of repetitious human genome sequences recently highlighted in the news is called tandem repeats (TRs). These are simply stretches of DNA comprised of two or more contiguous copies of a "word" (called a motif) arranged in a head-to-tail pattern. For example, the TR "ttacttacttacttacgttac" is simply a repeat of the four-base motif "ttac" five times. Amazingly, these TRs are found all over the human genome: inside genes, outside genes, and even inside the protein-coding regions of genes. Among individual humans, many TRs vary in the length of the repeat. They have been used in forensics as highly effective DNA markers to solve criminal and paternity cases.

Despite knowing about these TR sequences and using them as reliable genetic markers, scientists have known very little about their actual function. Historically, anomalies like these repeating sequences, that seem to make little sense upon first glance, were often relegated to the trash bin of "junk DNA."

However, one group of researchers recently took a different approach and hypothesized that these sequences may have a purpose. They developed a set of experiments to test the effect of TRs on gene expression and the epigenetic modification of DNA. Epigenetic modification is the addition of molecular tags to the DNA molecule without changing the actual DNA sequence. The result is altered gene expression.

As a consequence of extensive testing using both existing and newly generated data sets, the researchers proclaim, "Our results suggest that there are potentially thousands of TR variants in the human genome that exert functional effects via alterations of local gene expression or epigenetics." They also state,

Our study assigns biological significance to TR variations in the human genome, and suggests that a significant fraction of TR variations exert functional effects via alterations of local gene expression or epigenetics. We conclude that targeted studies that focus on genotyping [genetic testing] TR variants are required to fully ascertain functional variation in the genome.1

These new data confirm a variety of previous studies that uncovered evidence of the functional role of TRs from their association with human diseases. As it turns out, several dozen heritable human diseases are directly associated with large repeat expansions in either coding or non-protein-coding regions of the genome.2 Clearly, these regions are under tight genetic control. When the repeats go outside their boundaries of allowable length variation, disease may be the result.

Once more we have a glaring example of demonstrated function in the genome for something once declared non-functional merely based on the fact that scientists didn't know its function—as if a lack of knowledge and understanding could somehow provide an adequate answer.

If a design-based approach were more widely taken during the course of genomic discovery, just think how much improvement would take place in our understanding of currently unknown features. Such an approach would also give glory to our great omnipotent Creator who is the Master Designer and Engineer of all life.

References

  1. Quilez, J. et al. 2016. Polymorphic tandem repeats within gene promoters act as modifiers of gene expression and DNA methylation in humans. Nucleic Acids Research. 44 (8): 3750-3762.
  2. Gemayel, R., M. D. Vinces, M. Legendre, and K. J. Verstrepen. 2010. Variable tandem repeats accelerate evolution of coding and regulatory sequences. Annual Review Genetics. 44: 445-477.

*Dr. Tomkins is Director of Life Sciences at the Institute for Creation Research and earned his Ph.D. in genetics from Clemson University.

Article posted on May 26, 2016.

The Latest
CREATION.LIVE PODCAST
Beauty for Beauty's Sake! | Creation.Live Podcast: Episode 17
Beauty is in the eye of the beholder, right? Or is beauty an objective standard? Where do our ideas of beauty even come from?   Hosts...

NEWS
Fire Sensory Capabilities of the Venus Flytrap
Fascinating discoveries have been made regarding the amazing Venus flytrap (Dionaea muscipula).1 For example, all parts of this amazing plant...

CREATION PODCAST
What Really Swallowed Jonah? | The Creation Podcast: Episode...
The book of Jonah contains the historical account of the prophet Jonah. In verse 17 of chapter 1, the text states that the Lord prepared a great...

NEWS
More Flood Evidence
Paleontologists recently discovered the partial fossils of two new species of dinosaur just outside of Casablanca. As stated in a Science Direct article,...

NEWS
New York Times Editorial: Big Bang Unraveling?
Two physicists have suggested in a recent New York Times guest editorial that Big Bang cosmology ‘may be starting to unravel.’1...

NEWS
Your Functional ''Yolk Sac''
For decades, evolutionists pointed to dozens of ‘useless artifacts’ of the human body to make their questionable case for evolution. But...

NEWS
The Beauty of Creation: Created for God’s Own Glory
Have you ever wondered why a sunset on a beach is captivating, snowcapped mountains are breathtaking, and a valley filled with wildflowers is enchanting? Scripture,...

CREATION PODCAST
Devastating, Dangerous, and Deadly Bacteria? | The Creation Podcast:...
Bacteria are everywhere! While we can't see them with the naked eye, these little critters are everywhere, even in and on your body! Some of...

NEWS
Pre-Flood Reptile Fossil Discovered With Baleen
Baleen whales (suborder Mysticeti) are amazing filter-feeding mammals of the sea. They belong to a group called the Cetacea. Evolutionists suggest they...

NEWS
September 2023 ICR Wallpaper
"If you walk in My statutes and keep My commandments, and perform them, then I will give you rain in its season, the land shall yield its produce, and...